M343

M343 is a genetic marker, announced in 2004, which defines a specific Y chromosome binary polymorphism. It now defines the Y chromosome haplogroup R1b (previously known as Hg1 and Eu18). This genetic marker is carried by most Western Europeans. It is carried by 70% of the entire population of England and 90% of some parts of Spain and Ireland and is also descended from the Cro-Magnon.

This marker is estimated to have originated in an individual male in Western Europe 30,000 or more years ago and has propagated since then to the population mentioned.

• Check out these links for more details link1, link2 and link3

It also is said that Europeans with mutation M343 descended from ten men whose roots go back to mutation M9 somewhere on the Khirgan steppes when a great division of people went their own ways to the east, north and west.

The technical details of M343 are:

Nucleotide  change: C to A
Position (base pair): 402
Total size (base pairs):424
Forward 5′→3′: tttaacctcctccagctctgca
Reverse 5′→3′: acccccacatatctccagg 

This refers to a particular 424 base-pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

M343 was announced in a group of 21 new Y-chromosome markers in

Human Genetics, Issue: Volume 114, Number 2
Date: January 2004, Pages: 127 - 148
Title: Excavating Y-chromosome haplotype strata in Anatolia
Authors: Cengiz Cinniolu, et al.

and has already been used in applications such as the Genographic Project. Note that M343 and M242 were the only two markers from this paper used by the Project.

See also

• List of binary polymorphisms

External links

• https://www5.nationalgeographic.com/genographic/atlas.html On this page, click on "Genetic Markers" and then on M343
• http://member.tripod.com/~midgley/dna.html
• http://home.cfl.rr.com/wade3/Haplogroup%20R1b.htm
• http://www.dnaheritage.com/ysnpmarkers.asp (note that it calls R1b as "R1c")
• http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf Paper lists 21 new genetic markers, including M343. Alternate URL