Familypedia
Advertisement
Mutation number NucleotideWp globe tiny.gif change Position (base pairWp globe tiny.gif) Total size (base pairsWp globe tiny.gif) Position Forward 5′→3′ Reverse 5′→3′
M1 (YAP) 291bp insertion
M2 AWp globe tiny.gif to GWp globe tiny.gif 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc
M3
M4
M8
M9
M15
M17
M20
M33
M35
M38
M40
M42
M45
M52
M55
M57
M60
M64.1
M75
M89
M91
M94
M95
M96
M105
M122
M124
M130
M131
M132
M139
M145
M170
M172
M173
M174
M175
M176
M179
M201
M203
M207
M213
M214
M216
M217
M231 GWp globe tiny.gif to AWp globe tiny.gif 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg
M241 GWp globe tiny.gif to AWp globe tiny.gif 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M242 CWp globe tiny.gif to TWp globe tiny.gif 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M253 CWp globe tiny.gif to TWp globe tiny.gif 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt
M258
M267 TWp globe tiny.gif to GWp globe tiny.gif 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M268
M285 GWp globe tiny.gif to CWp globe tiny.gif 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M286 GWp globe tiny.gif to AWp globe tiny.gif 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M287 AWp globe tiny.gif to TWp globe tiny.gif 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M299
M304 AWp globe tiny.gif to CWp globe tiny.gif 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt
M306
M335 TWp globe tiny.gif to AWp globe tiny.gif 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta
M339 TWp globe tiny.gif to GWp globe tiny.gif 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt
M340 GWp globe tiny.gif to CWp globe tiny.gif 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa
M342 CWp globe tiny.gif to TWp globe tiny.gif 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact
M343Wp globe tiny.gif CWp globe tiny.gif to AWp globe tiny.gif 402 424 tttaacctcctccagctctgca acccccacatatctccagg
M347
M349 GWp globe tiny.gif to TWp globe tiny.gif 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct
M356
M359 TWp globe tiny.gif to CWp globe tiny.gif 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt
M365 AWp globe tiny.gif to GWp globe tiny.gif 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M367 AWp globe tiny.gif to GWp globe tiny.gif 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M368 AWp globe tiny.gif to CWp globe tiny.gif 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M369 GWp globe tiny.gif to CWp globe tiny.gif 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M370 CWp globe tiny.gif to GWp globe tiny.gif 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg

External links

See also

This page uses content from the English language Wikipedia. The original content was at List of binary polymorphisms. The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License.
Advertisement