m (wp xfer) |
m (AWB cleanup- template:wp) |
||
Line 1: | Line 1: | ||
{| class="wikitable" |
{| class="wikitable" |
||
!Mutation number |
!Mutation number |
||
− | ! |
+ | ![[Nucleotide|Nucleotide]] change |
− | !Position ( |
+ | !Position ([[Wikipedia:base pair|base pair]]) |
− | !Total size ( |
+ | !Total size ([[Wikipedia:base pair|base pairs]]) |
!Position Forward 5′→3′ |
!Position Forward 5′→3′ |
||
!Reverse 5′→3′ |
!Reverse 5′→3′ |
||
Line 15: | Line 15: | ||
|- |
|- |
||
!M2 |
!M2 |
||
− | | |
+ | |[[Wikipedia:Adenine|A]] to [[Wikipedia:Guanine|G]] |
|168 |
|168 |
||
|209 |
|209 |
||
Line 344: | Line 344: | ||
|- |
|- |
||
!M231 |
!M231 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Adenine|A]] |
|110 |
|110 |
||
|331 |
|331 |
||
Line 351: | Line 351: | ||
|- |
|- |
||
!M241 |
!M241 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Adenine|A]] |
|54 |
|54 |
||
|366 |
|366 |
||
Line 358: | Line 358: | ||
|- |
|- |
||
!M242 |
!M242 |
||
− | | |
+ | |[[Wikipedia:Cytosine|C]] to [[Wikipedia:Thymine|T]] |
|180 |
|180 |
||
|366 |
|366 |
||
Line 365: | Line 365: | ||
|- |
|- |
||
!M253 |
!M253 |
||
− | | |
+ | |[[Wikipedia:Cytosine|C]] to [[Wikipedia:Thymine|T]] |
|283 |
|283 |
||
|400 |
|400 |
||
Line 379: | Line 379: | ||
|- |
|- |
||
!M267 |
!M267 |
||
− | | |
+ | |[[Wikipedia:Thymine|T]] to [[Wikipedia:Guanine|G]] |
|148 |
|148 |
||
|287 |
|287 |
||
Line 393: | Line 393: | ||
|- |
|- |
||
!M285 |
!M285 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Cytosine|C]] |
|70 |
|70 |
||
|287 |
|287 |
||
Line 400: | Line 400: | ||
|- |
|- |
||
!M286 |
!M286 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Adenine|A]] |
|129 |
|129 |
||
|287 |
|287 |
||
Line 407: | Line 407: | ||
|- |
|- |
||
!M287 |
!M287 |
||
− | | |
+ | |[[Wikipedia:Adenine|A]] to [[Wikipedia:Thymine|T]] |
|100 |
|100 |
||
|287 |
|287 |
||
Line 421: | Line 421: | ||
|- |
|- |
||
!M304 |
!M304 |
||
− | | |
+ | |[[Wikipedia:Adenine|A]] to [[Wikipedia:Cytosine|C]] |
|421 |
|421 |
||
|527 |
|527 |
||
Line 435: | Line 435: | ||
|- |
|- |
||
!M335 |
!M335 |
||
− | | |
+ | |[[Wikipedia:Thymine|T]] to [[Wikipedia:Adenine|A]] |
|162 |
|162 |
||
|417 |
|417 |
||
Line 442: | Line 442: | ||
|- |
|- |
||
!M339 |
!M339 |
||
− | | |
+ | |[[Wikipedia:Thymine|T]] to [[Wikipedia:Guanine|G]] |
|285 |
|285 |
||
|517 |
|517 |
||
Line 449: | Line 449: | ||
|- |
|- |
||
!M340 |
!M340 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Cytosine|C]] |
|218 |
|218 |
||
|386 |
|386 |
||
Line 456: | Line 456: | ||
|- |
|- |
||
!M342 |
!M342 |
||
− | | |
+ | |[[Wikipedia:Cytosine|C]] to [[Wikipedia:Thymine|T]] |
|52 |
|52 |
||
|173 |
|173 |
||
Line 462: | Line 462: | ||
|tgggaatcacttttgcaact |
|tgggaatcacttttgcaact |
||
|- |
|- |
||
− | ! |
+ | ![[M343|M343]] |
− | | |
+ | |[[Wikipedia:Cytosine|C]] to [[Wikipedia:Adenine|A]] |
|402 |
|402 |
||
|424 |
|424 |
||
Line 477: | Line 477: | ||
|- |
|- |
||
!M349 |
!M349 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Thymine|T]] |
|209 |
|209 |
||
|493 |
|493 |
||
Line 491: | Line 491: | ||
|- |
|- |
||
!M359 |
!M359 |
||
− | | |
+ | |[[Wikipedia:Thymine|T]] to [[Wikipedia:Cytosine|C]] |
|122 |
|122 |
||
|447 |
|447 |
||
Line 498: | Line 498: | ||
|- |
|- |
||
!M365 |
!M365 |
||
− | | |
+ | |[[Wikipedia:Adenine|A]] to [[Wikipedia:Guanine|G]] |
|246 |
|246 |
||
|274 |
|274 |
||
Line 505: | Line 505: | ||
|- |
|- |
||
!M367 |
!M367 |
||
− | | |
+ | |[[Wikipedia:Adenine|A]] to [[Wikipedia:Guanine|G]] |
|196 |
|196 |
||
|274 |
|274 |
||
Line 512: | Line 512: | ||
|- |
|- |
||
!M368 |
!M368 |
||
− | | |
+ | |[[Wikipedia:Adenine|A]] to [[Wikipedia:Cytosine|C]] |
|200 |
|200 |
||
|274 |
|274 |
||
Line 519: | Line 519: | ||
|- |
|- |
||
!M369 |
!M369 |
||
− | | |
+ | |[[Wikipedia:Guanine|G]] to [[Wikipedia:Cytosine|C]] |
|45 |
|45 |
||
|274 |
|274 |
||
Line 526: | Line 526: | ||
|- |
|- |
||
!M370 |
!M370 |
||
− | | |
+ | |[[Wikipedia:Cytosine|C]] to [[Wikipedia:Guanine|G]] |
|166 |
|166 |
||
|274 |
|274 |
||
Line 538: | Line 538: | ||
==See also== |
==See also== |
||
− | * |
+ | *[[Single nucleotide polymorphism|Single nucleotide polymorphism]] |
− | * |
+ | *[[Unique event polymorphism|Unique event polymorphism]] |
− | * |
+ | *[[Human Y-chromosome DNA haplogroups|Human Y-chromosome DNA haplogroups]] |
− | * |
+ | *[[List of DYS markers|List of DYS markers]] |
[[Category:DNA]] |
[[Category:DNA]] |
Latest revision as of 19:14, 27 June 2009
Mutation number | Nucleotide change | Position (base pair) | Total size (base pairs) | Position Forward 5′→3′ | Reverse 5′→3′ |
---|---|---|---|---|---|
M1 (YAP) | 291bp insertion | ||||
M2 | A to G | 168 | 209 | aggcactggtcagaatgaag | aatggaaaatacagctcccc |
M3 | |||||
M4 | |||||
M8 | |||||
M9 | |||||
M15 | |||||
M17 | |||||
M20 | |||||
M33 | |||||
M35 | |||||
M38 | |||||
M40 | |||||
M42 | |||||
M45 | |||||
M52 | |||||
M55 | |||||
M57 | |||||
M60 | |||||
M64.1 | |||||
M75 | |||||
M89 | |||||
M91 | |||||
M94 | |||||
M95 | |||||
M96 | |||||
M105 | |||||
M122 | |||||
M124 | |||||
M130 | |||||
M131 | |||||
M132 | |||||
M139 | |||||
M145 | |||||
M170 | |||||
M172 | |||||
M173 | |||||
M174 | |||||
M175 | |||||
M176 | |||||
M179 | |||||
M201 | |||||
M203 | |||||
M207 | |||||
M213 | |||||
M214 | |||||
M216 | |||||
M217 | |||||
M231 | G to A | 110 | 331 | cctattatcctggaaaatgtgg | attccgattcctagtcacttgg |
M241 | G to A | 54 | 366 | aactcttgataaaccgtgctg | tccaatctcaattcatgcctc |
M242 | C to T | 180 | 366 | aactcttgataaaccgtgctg | tccaatctcaattcatgcctc |
M253 | C to T | 283 | 400 | gcaacaatgagggtttttttg | cagctccacctctatgcagttt |
M258 | |||||
M267 | T to G | 148 | 287 | ttatcctgagccgttgtccctg | tgtagagacacggttgtaccct |
M268 | |||||
M285 | G to C | 70 | 287 | ttatcctgagccgttgtccctg | tgtagagacacggttgtaccct |
M286 | G to A | 129 | 287 | ttatcctgagccgttgtccctg | tgtagagacacggttgtaccct |
M287 | A to T | 100 | 287 | ttatcctgagccgttgtccctg | tgtagagacacggttgtaccct |
M299 | |||||
M304 | A to C | 421 | 527 | caaagtgctgggattacagg | cttctagcttcatctgcattgt |
M306 | |||||
M335 | T to A | 162 | 417 | aagaaatgttgaactgaaagttgat | aggtgtatctggcatccgtta |
M339 | T to G | 285 | 517 | aggcaggacaactgagagca | tgcttgatcctgggaagt |
M340 | G to C | 218 | 386 | ccagtcagcagtacaaaagttg | gcatttctttgattatagaagcaa |
M342 | C to T | 52 | 173 | agagagttttctaacagggcg | tgggaatcacttttgcaact |
M343 | C to A | 402 | 424 | tttaacctcctccagctctgca | acccccacatatctccagg |
M347 | |||||
M349 | G to T | 209 | 493 | tgggattaaaggtgctcatg | caaaattggtaagccattagct |
M356 | |||||
M359 | T to C | 122 | 447 | cgtctatggccttgaaga | tccgaaaatgcagacttt |
M365 | A to G | 246 | 274 | ccttcatttaggctgtagctgc | tgtatctttagttgagatgg |
M367 | A to G | 196 | 274 | ccttcatttaggctgtagctgc | tgtatctttagttgagatgg |
M368 | A to C | 200 | 274 | ccttcatttaggctgtagctgc | tgtatctttagttgagatgg |
M369 | G to C | 45 | 274 | ccttcatttaggctgtagctgc | tgtatctttagttgagatgg |
M370 | C to G | 166 | 274 | ccttcatttaggctgtagctgc | tgtatctttagttgagatgg |
External links[]
See also[]
- Single nucleotide polymorphism
- Unique event polymorphism
- Human Y-chromosome DNA haplogroups
- List of DYS markers
This page uses content from the English language Wikipedia. The original content was at List of binary polymorphisms. The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License. |