Familypedia
Don't have an account?
Register
Register

Editing List of binary polymorphisms

Back to page
Edit
Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.

The edit can be undone. Please check the comparison below to verify that this is what you want to do, and then publish the changes below to finish undoing the edit.

Latest revision Your text
Line 1: Line 1:
 
{| class="wikitable"
  
{| class="wikitable"
 
!Mutation number
  
!Mutation number
−
![[Nucleotide|Nucleotide]] change
 +
!{{wp|Nucleotide}} change
−
!Position ([[Wikipedia:base pair|base pair]])
 +
!Position ({{wp|base pair}})
−
!Total size ([[Wikipedia:base pair|base pairs]])
 +
!Total size ({{wp|base pair|base pairs}})
 
!Position Forward 5′→3′
  
!Position Forward 5′→3′
 
!Reverse 5′→3′
  
!Reverse 5′→3′
Line 15: Line 15:
 
|-
  
|-
 
!M2
  
!M2
−
|[[Wikipedia:Adenine|A]] to [[Wikipedia:Guanine|G]]
 +
|{{wp|Adenine|A}} to {{wp|Guanine|G}}
 
|168
  
|168
 
|209
  
|209
Line 344: Line 344:
 
|-
  
|-
 
!M231
  
!M231
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Adenine|A]]
 +
|{{wp|Guanine|G}} to {{wp|Adenine|A}}
 
|110
  
|110
 
|331
  
|331
Line 351: Line 351:
 
|-
  
|-
 
!M241
  
!M241
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Adenine|A]]
 +
|{{wp|Guanine|G}} to {{wp|Adenine|A}}
 
|54
  
|54
 
|366
  
|366
Line 358: Line 358:
 
|-
  
|-
 
!M242
  
!M242
−
|[[Wikipedia:Cytosine|C]] to [[Wikipedia:Thymine|T]]
 +
|{{wp|Cytosine|C}} to {{wp|Thymine|T}}
 
|180
  
|180
 
|366
  
|366
Line 365: Line 365:
 
|-
  
|-
 
!M253
  
!M253
−
|[[Wikipedia:Cytosine|C]] to [[Wikipedia:Thymine|T]]
 +
|{{wp|Cytosine|C}} to {{wp|Thymine|T}}
 
|283
  
|283
 
|400
  
|400
Line 379: Line 379:
 
|-
  
|-
 
!M267
  
!M267
−
|[[Wikipedia:Thymine|T]] to [[Wikipedia:Guanine|G]]
 +
|{{wp|Thymine|T}} to {{wp|Guanine|G}}
 
|148
  
|148
 
|287
  
|287
Line 393: Line 393:
 
|-
  
|-
 
!M285
  
!M285
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Cytosine|C]]
 +
|{{wp|Guanine|G}} to {{wp|Cytosine|C}}
 
|70
  
|70
 
|287
  
|287
Line 400: Line 400:
 
|-
  
|-
 
!M286
  
!M286
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Adenine|A]]
 +
|{{wp|Guanine|G}} to {{wp|Adenine|A}}
 
|129
  
|129
 
|287
  
|287
Line 407: Line 407:
 
|-
  
|-
 
!M287
  
!M287
−
|[[Wikipedia:Adenine|A]] to [[Wikipedia:Thymine|T]]
 +
|{{wp|Adenine|A}} to {{wp|Thymine|T}}
 
|100
  
|100
 
|287
  
|287
Line 421: Line 421:
 
|-
  
|-
 
!M304
  
!M304
−
|[[Wikipedia:Adenine|A]] to [[Wikipedia:Cytosine|C]]
 +
|{{wp|Adenine|A}} to {{wp|Cytosine|C}}
 
|421
  
|421
 
|527
  
|527
Line 435: Line 435:
 
|-
  
|-
 
!M335
  
!M335
−
|[[Wikipedia:Thymine|T]] to [[Wikipedia:Adenine|A]]
 +
|{{wp|Thymine|T}} to {{wp|Adenine|A}}
 
|162
  
|162
 
|417
  
|417
Line 442: Line 442:
 
|-
  
|-
 
!M339
  
!M339
−
|[[Wikipedia:Thymine|T]] to [[Wikipedia:Guanine|G]]
 +
|{{wp|Thymine|T}} to {{wp|Guanine|G}}
 
|285
  
|285
 
|517
  
|517
Line 449: Line 449:
 
|-
  
|-
 
!M340
  
!M340
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Cytosine|C]]
 +
|{{wp|Guanine|G}} to {{wp|Cytosine|C}}
 
|218
  
|218
 
|386
  
|386
Line 456: Line 456:
 
|-
  
|-
 
!M342
  
!M342
−
|[[Wikipedia:Cytosine|C]] to [[Wikipedia:Thymine|T]]
 +
|{{wp|Cytosine|C}} to {{wp|Thymine|T}}
 
|52
  
|52
 
|173
  
|173
Line 462: Line 462:
 
|tgggaatcacttttgcaact
  
|tgggaatcacttttgcaact
 
|-
  
|-
−
![[M343|M343]]
 +
!{{wp|M343}}
−
|[[Wikipedia:Cytosine|C]] to [[Wikipedia:Adenine|A]]
 +
|{{wp|Cytosine|C}} to {{wp|Adenine|A}}
 
|402
  
|402
 
|424
  
|424
Line 477: Line 477:
 
|-
  
|-
 
!M349
  
!M349
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Thymine|T]]
 +
|{{wp|Guanine|G}} to {{wp|Thymine|T}}
 
|209
  
|209
 
|493
  
|493
Line 491: Line 491:
 
|-
  
|-
 
!M359
  
!M359
−
|[[Wikipedia:Thymine|T]] to [[Wikipedia:Cytosine|C]]
 +
|{{wp|Thymine|T}} to {{wp|Cytosine|C}}
 
|122
  
|122
 
|447
  
|447
Line 498: Line 498:
 
|-
  
|-
 
!M365
  
!M365
−
|[[Wikipedia:Adenine|A]] to [[Wikipedia:Guanine|G]]
 +
|{{wp|Adenine|A}} to {{wp|Guanine|G}}
 
|246
  
|246
 
|274
  
|274
Line 505: Line 505:
 
|-
  
|-
 
!M367
  
!M367
−
|[[Wikipedia:Adenine|A]] to [[Wikipedia:Guanine|G]]
 +
|{{wp|Adenine|A}} to {{wp|Guanine|G}}
 
|196
  
|196
 
|274
  
|274
Line 512: Line 512:
 
|-
  
|-
 
!M368
  
!M368
−
|[[Wikipedia:Adenine|A]] to [[Wikipedia:Cytosine|C]]
 +
|{{wp|Adenine|A}} to {{wp|Cytosine|C}}
 
|200
  
|200
 
|274
  
|274
Line 519: Line 519:
 
|-
  
|-
 
!M369
  
!M369
−
|[[Wikipedia:Guanine|G]] to [[Wikipedia:Cytosine|C]]
 +
|{{wp|Guanine|G}} to {{wp|Cytosine|C}}
 
|45
  
|45
 
|274
  
|274
Line 526: Line 526:
 
|-
  
|-
 
!M370
  
!M370
−
|[[Wikipedia:Cytosine|C]] to [[Wikipedia:Guanine|G]]
 +
|{{wp|Cytosine|C}} to {{wp|Guanine|G}}
 
|166
  
|166
 
|274
  
|274
Line 538: Line 538:
   
 
==See also==
  
==See also==
−
*[[Single nucleotide polymorphism|Single nucleotide polymorphism]]
 +
*{{wp|Single nucleotide polymorphism}}
−
*[[Unique event polymorphism|Unique event polymorphism]]
 +
*{{wp|Unique event polymorphism}}
−
*[[Human Y-chromosome DNA haplogroups|Human Y-chromosome DNA haplogroups]]
 +
*{{wp|Human Y-chromosome DNA haplogroups}}
−
*[[List of DYS markers|List of DYS markers]]
 +
*{{wp|List of DYS markers}}
   
 
[[Category:DNA]]
  
[[Category:DNA]]
Please note that all contributions to the Familypedia are considered to be released under the CC-BY-SA
Cancel Editing help (opens in new window)
Below are some commonly used wiki markup codes. Simply click on what you want to use and it will appear in the edit box above.

View this template

Templates used on this page: