Mutation number Nucleotide change Position (base pair) Total size (base pairs) Position Forward 5′→3′ Reverse 5′→3′
M1 (YAP) 291bp insertion
M2 A to G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc
M231 G to A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg
M241 G to A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M242 C to T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M253 C to T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt
M267 T to G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M285 G to C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M286 G to A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M287 A to T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M304 A to C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt
M335 T to A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta
M339 T to G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt
M340 G to C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa
M342 C to T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact
M343 C to A 402 424 tttaacctcctccagctctgca acccccacatatctccagg
M349 G to T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct
M359 T to C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt
M365 A to G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M367 A to G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M368 A to C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M369 G to C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M370 C to G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg

External links[edit | edit source]

See also[edit | edit source]

This page uses content from the English language Wikipedia. The original content was at List of binary polymorphisms. The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License.
Community content is available under CC-BY-SA unless otherwise noted.